Search Olfactory receptors

(e.g. OR1G1, AF087928, Segregating Pseudo)

Select ORs from

Family: Subfamily:

Chromosome:

OR4C4P Olfactory Receptor

Gene Symbol OR4C4P1 (View this gene in GeneCards)
Family 4
Subfamily C
Pseudogene Yes
CORP pseudogene probability score
Aliases OR11-101, HsOR11.8.7P, ORL3740
External Ids HGNC: 14700   GeneBank: BK004583   ORDB: ORL3740   
Build #39 labels OR4C4P, OR4C17P
Chromosomal location 11:48,345,351-48,352,456 (-)
Cluster 11@48
Synteny CLIC#26
Remarks On november 20, 2010 OR4C4P was merged wirh OR4C17P. The two ORs code for a single pseudogene, disrupted by Line repeat.

Most Similar ORs in Humans (Paralogs)

Symbol Percent Length
OR4C45 91.39% 209

Most Similar ORs in other species (Orthologs)

Specie Symbol Percent Length
Chimp CONTIG6079.1-1119 97% 210
Chimp CONTIG2000.11-2742 92% 209

Expression evidences

Source Accession
mRNA AB528861

Sequence information

Nucleotide sequence ATGAAAAAGATGAACAATGTAATAGAATTCATACTGCTGGGCCTCACTCACAATCCAGAA
CTGCAGAAATTCTTGTTTGTTATGTTTTTAATCACCTACTTGATCACATTGGCAGGTAAC
CTGTTCATCTCAGTCATCATCTTCATCAGCCCAGCCCTGGGTTCCCCCATGTACTCTTTT
CCGTCCTATTTGTTCATTATAGACATTTTCTGCTCTTCTTCCATAGCCCCTAAAATGAAC
TTTGACTTGATCTCTGAAAAGAACACCATATCCTTCAATGGCTGCATGACTCAGCTCTTC
ACAGAACATTTCTTTGAGGCAGCTGAGATCATCTTATTAAGTGTCATGGCCTATGACCAC
TATGTGGCCATCCGTAAGCCCTTGCACTATGCAACCATCATGAGCCAACCTATGTGTGGA
TTCCTGATGGTGGTGGCTGGGATTCTGGGATTTGTGCATGGAGGGATCCAGACTTTGTTC
ATAGCCCAGTTACCATTCTGTGGCCCCAATGTCATCAACCACTTTATGTGTGATTTAGTA
CCTCTTCTGGAGCTGGCCTGCACAGACACTCACACCTTGGGGCCTCTGATTGCTGCCAAC
AGTGGGTCACTGTGTTTCCTCATTTTTTCCATGCTGGTTGCTTCCTATGTCATCATCCTG
TGCTTCCTGAGGACTCATAGCTCTGAAGGGCGTCGCAAAGCTCTGTCTAGTTGTGCCTCT
CATATCTTCATTGTCATCTTATTCTTTGTCCCTTTTTCATACCTGTATCTAAGACCTAAC
CTCCTTCCCCACTGACAAAGCTGTGACTGTGTTTTGCACCCTATTTACACCTATGTTGAA
CCCTTTAATCTACACCCTCAAAAATAAAGAAGTGAAAAATGTCATTAAGAAGCTCTGGAA
GCAAATAATGACAACTGATGATAAA
Conceptual translation

Protein domains and features

Variations - SNPs

Chr Start End Type Variation AA Change SNP IDs
11 48,373,747 48,373,747 Del(1) -/T rs71045567 (DbSNP)
11 48,374,007 48,374,006 Ins(1) -/T rs66770722 (DbSNP)
11 48,374,002 48,374,001 Ins(1) -/T rs66929749 (DbSNP)
11 48,367,054 48,367,053 Ins(2) -/AG rs66653913 (DbSNP)
11 48,367,052 48,367,051 Ins(2) -/AG rs34597308 (DbSNP)
11 48,367,529 48,367,529 large insertion 6181bp insertion rs71787435 (DbSNP)
11 48,373,946 48,373,946 SNP A/C rs12797020 (DbSNP)
11 48,367,073 48,367,073 SNP A/C rs7941588 (DbSNP)
11 48,367,097 48,367,097 SNP A/G rs73453179 (DbSNP)
11 48,367,499 48,367,499 SNP A/G rs72896822 (DbSNP)
11 48,373,770 48,373,770 SNP A/T rs73453191 (DbSNP)
11 48,373,820 48,373,820 SNP C/A rs3898634 (DbSNP)
11 48,373,748 48,373,748 SNP C/G rs73453188 (DbSNP)
11 48,373,797 48,373,797 SNP C/T rs72896825 (DbSNP)
11 48,367,363 48,367,363 SNP C/T rs73453183 (DbSNP)
11 48,367,311 48,367,311 SNP C/T rs73453180 (DbSNP)
11 48,373,986 48,373,986 SNP G/A rs12420054 (DbSNP)
11 48,367,511 48,367,511 SNP G/T rs72896823 (DbSNP)
11 48,345,406 48,345,406 SNP T/G 1000GP (CEU, CHBJPT)
11 48,345,419 48,345,419 SNP G/C 1000GP (CEU, CHBJPT)
11 48,345,697 48,345,697 SNP C/T 1000GP (CEU)
11 48,345,700 48,345,700 SNP G/A 1000GP (CEU)
11 48,345,835 48,345,835 SNP C/T 1000GP (CEU)
11 48,345,903 48,345,903 SNP G/A 1000GP (CEU, CHBJPT)
11 48,345,918 48,345,918 SNP G/A 1000GP (CEU)
11 48,345,947 48,345,947 SNP A/G 1000GP (CEU, CHBJPT)
11 48,345,959 48,345,959 SNP T/G 1000GP (CEU, CHBJPT)
11 48,352,245 48,352,245 SNP C/T 1000GP (CEU, CHBJPT)
11 48,352,253 48,352,253 SNP G/A 1000GP (CEU, CHBJPT)
11 48,352,394 48,352,394 SNP C/A 1000GP (CEU, CHBJPT)
11 48,352,424 48,352,424 SNP T/G 1000GP (CEU, CHBJPT)
11 48,352,434 48,352,434 SNP A/G 1000GP (CEU, CHBJPT)
11 48,345,420 48,345,420 SNP G/A 1000GP (CHBJPT)
11 48,352,196 48,352,196 SNP C/G 1000GP (CHBJPT)
11 48,352,218 48,352,218 SNP T/A 1000GP (CHBJPT)
11 48,352,263 48,352,263 SNP A/G 1000GP (CHBJPT)
11 48,352,265 48,352,265 SNP C/T 1000GP (CHBJPT)
11 48,352,275 48,352,275 SNP G/A 1000GP (CHBJPT)
11 48,352,333 48,352,333 SNP A/G 1000GP (CHBJPT)
11 48,352,348 48,352,348 SNP A/G 1000GP (CHBJPT)
11 48,352,384 48,352,384 SNP A/G 1000GP (CHBJPT)
11 48,352,447 48,352,447 SNP T/C 1000GP (CHBJPT)
11 100 -100 SNP T/G 1000GP (YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI)

Variations - CNVs

Chr Start End Type Sources
11 48,365,757 49,068,634 CopyNumber Variation_2922 (DGV), Variation_2922 (DGV)
11 48,303,671 48,863,606 CopyNumber Variation_3848 (DGV), Variation_3848 (DGV)
11 48,367,529 48,373,709 CopyNumber Variation_5626 (DGV), Variation_5626 (DGV)
11 48,346,202 48,972,502 CopyNumber Variation_9183 (DGV), Variation_9183 (DGV)
11 48,367,292 48,375,858 CopyNumber Variation_23169 (DGV), Variation_23169 (DGV)
11 48,367,271 48,373,949 CopyNumber Variation_61136 (DGV), Variation_61136 (DGV)
11 48,366,970 48,374,599 CopyNumber Variation_101213 (DGV), Variation_101213 (DGV)
11 48,371,686 48,374,108 CopyNumber #150 (Waszak)
11 48,364,903 48,367,630 CopyNumber #173 (Waszak)
11 48,367,475 48,373,868 Del(-6183) #10(modil), #11(modil)

Haplotypes

Protein haplotypes were calculated using the 1000 genomes project as described in Olender T. et. al. BMC Genomics 2012.