Search Olfactory receptors

(e.g. OR1G1, AF087928, Segregating Pseudo)

Select ORs from

Family: Subfamily:

Chromosome:

OR5BL1P Olfactory Receptor

Gene Symbol OR5BL1P1 (View this gene in GeneCards)
Family 5
Subfamily BL
Pseudogene Yes
CORP pseudogene probability score
Aliases ORL3550
External Ids HGNC: 15275   GeneBank: NG_004200   ORDB: ORL3550   
Build #39 labels OR5BL1P
Chromosomal location 11:58,171,089-58,171,721 (+)
Cluster 11@58
Synteny CLIC#27
Remarks

Most Similar ORs in Humans (Paralogs)

Symbol Percent Length
OR5AU1 33.82% 207
OR9Q1 36.62% 213
OR9Q2 36.92% 195

Most Similar ORs in other species (Orthologs)

Specie Symbol Percent Length
Dog OR5BP1P 36% 201
Chimp CONTIG229.242-7327 92% 210
Mouse Or9q1 37% 202
Rat Or9q1 37% 201
Cow OR9Q6 34% 196

Expression evidences

Source Accession
ESTs BI772562
mRNA BC110819

Sequence information

Nucleotide sequence ATTTGACTGAAATTGATCTTTGGAAATCCTAGATAGTAATAGATTTTCAGATGTGTCTAT
GATTATTTTGTGGGACTGTCAACCCTTGCTTTATGACACCATCACAACTCTCAAGATGTC
TGGCAGAAGCTGGTGACTGCATATTGTAGAGGGTTTGACAAATGTAATCCAATGTATACA
CTTCACCTGCTCACTCTCCTTTTGTGCCTTCATCTATAGGTTTCACTCTCTGTGACCTCC
ATTGCTGCTGACCCTGAATTGGGTGATAGCTTCCTCCAGCAGCTGCTGATTTTTCACTTT
GCTCTGTATATGATTCTGACCAGACTAGTTTTGATCCTGTTCTCTGACTTGTTCATCAGC
AAGGCCATCTAAACACCTGCAAATCAGGTCTCTAGGCAAAGATTCCTCAACCTTTTTCTA
CCTTTGCCTCATGCAGAACTGCAGTTCGGTTGATTGTTGAGACTACAGCTTTGATCTATG
TGTGCAGCAGTAGGCAAGTCCCTTACAGGGGAGAGGGCCGTGACCATGTTTTAGACTGTA
GTGAACACCAGGCTGACCATTCCAATTTTATAGCCTGAGGAAAAAAAGGCAAAGGAGGCC
CTGAGGAAAGGTCTTAATAAAGCCAAGTTGTTC
Conceptual translation IXKLIFGNPRXXFRCVYDYFV//CQPLLYDTITTLKM/WQKLVTAY\EGLTNV
IQCIHFTCSLSFCAFIYRFHSLXPLLLTL/LGDSFLQQLLIFHFALYMILTRLVLILF
SDLFISKAIXPANQVSRQRFLNL/STFASCRTAVRLIVETTALIYVCSS\KSLTGER
AVTMFXVVNTRLTIPILXEEKKAKEALRKGLNKAKLF

Protein domains and features

Variations - SNPs

Chr Start End Type Variation AA Change SNP IDs
11 100 -100 SNP A/T 1000GP (YRI, YRI, YRI, YRI, YRI)
11 57,938,891 57,938,891 SNP C/T rs10750888 (DbSNP)
11 57,939,147 57,939,147 Del(1) -/A rs58347336 (DbSNP)
11 58,171,089 58,171,089 SNP A/T 1000GP (CEU, CHBJPT)
11 58,171,161 58,171,161 SNP G/C 1000GP (CEU)
11 58,171,419 58,171,419 SNP T/C 1000GP (CEU, CHBJPT)
11 58,171,680 58,171,680 SNP A/G 1000GP (CEU)

Variations - CNVs

Chr Start End Type Sources
11 57,912,509 57,948,750 CopyNumber Variation_4745 (DGV)

Haplotypes

Protein haplotypes were calculated using the 1000 genomes project as described in Olender T. et. al. BMC Genomics 2012.