Search Olfactory receptors

(e.g. OR1G1, AF087928, Segregating Pseudo)

Select ORs from

Family: Subfamily:

Chromosome:

OR8G1 Olfactory Receptor

Gene Symbol OR8G11 (View this gene in GeneCards)
Family 8
Subfamily G
Pseudogene No
CORP pseudogene probability score
Aliases OR11-296, HSTPCR25, OR11-281, HsOR11.18.24P, ORL209
External Ids HGNC: 8484   GeneBank: AB065946, AF399507, BK004423, BK004659, HSTPCR25P, NM_001002905, XM_499553   ORDB: ORL209   
Build #39 labels OR8G1
Chromosomal location 11:124,249,676-124,251,438 (+)
Cluster 11@124
Synteny CLIC#29
Remarks Segregating Pseudo Gene, a nonsynonymous SNP rs4268525 (AA change=Y/* )

Most Similar ORs in Humans (Paralogs)

Symbol Percent Length

Most Similar ORs in other species (Orthologs)

Specie Symbol Percent Length
Dog OR8G5 82% 311
Mouse Or8g23 79% 308
Rat Or8g20 77% 311
Cow OR8G5 80% 311
Cow OR8G5B 82% 311

Expression evidences

Source Accession
mRNA X89672

Sequence information

Nucleotide sequence ATGTCAGGAGAAAATAATTCCTCAGTGACTGAGTTCATTCTGGCTGGGCTCTCAGAACAG
CCAGAGCTCCAGCTGCCCCTCTTCCTCCTGTTCTTAGGAATCTATGTGGTCACAGTGGTG
GGCAACCTGGGCATGACCACACTGATTTGGCTCAGTTCTCACCTGCACACCCCTATGTAC
TATTTCCTCAGCAGTCTGTCCTTCATTGACTTCTGCCATTCCACTGTCATTACCCCTAAG
ATGCTGGTGAACTTTGTGACAGAGAAGAACATCATCTCCTACCCTGAATGCATGACTCAG
CTCTACTTCTTCCTCGTTTTTGCTATTGCAGAGTGTCACATGTTGGCTGCAATGGCGTAT
GACCGTTACATGGCCATCTGTAGCCCCTTGCTGTACAGTGTCATCATATCCAATAAGGCT
TGCTTTTCTCTGATTTTAGGGGTGTATATAATAGGCCTGGTTTGTGCATCAGTTCATACA
GGCTGTATGTTTAGGGTTCAATTCTGCAAATTTGATTTGATTAACCATTATTTCTGTGAT
CTTCTTCCCCTCCTAAAGCTCTCTTGCTCTAGTATCTATGTCAACAAACTACTTATTCTA
TGTGTTGGTGCATTTAACATCCTTGTCCCCAGCCTGACCATCCTTTGCTCTTACATCTTT
ATTATTGCCAGCATCCTCCACATTCGCTCCACTGAGGGCAGGTCCAAAGCCTTCAGCACT
TGTAGCTCCCACATGTTGGCGGTTGTAATCTTTTTTGGATCTGCAGCATTCATGTAGTTG
CAGCCATCTTCAATCAGCTCCATGGACCAGGGGAAAGTATCCTCTGTGTTTTATACTATT
ATTGTGCCCATGTTGAACCCTCTGAGCTACATATGTTTTTAAATCTAATCTAATTTAATT
TATATTTCAAGT
Conceptual translation

Protein domains and features

Variations - SNPs

Chr Start End Type Variation AA Change SNP IDs
11 100 -100 nonsense SNP G/C */Y 1000GP (YRI)
11 100 -100 NS A/G S/G 1000GP (YRI, YRI)
11 100 -100 SYN T/C S/S 1000GP (YRI, YRI)
11 124,120,821 124,120,821 SYN C/T S/S rs12099154 (DbSNP)
11 124,121,162 124,121,162 NS C/T A/V rs4482039 (DbSNP)
11 124,121,199 124,121,199 nonsense SNP C/G Y/* rs4268525 (DbSNP)
11 124,121,288 124,121,287 Ins(851) Ins rs71019875 (DbSNP)
11 124,250,074 124,250,074 SYN T/C S/S 1000GP (CEU, CHBJPT)
11 124,250,415 124,250,415 NS C/T A/V 1000GP (CHBJPT)
11 124,250,452 124,250,452 nonsense SNP G/C */Y 1000GP (CEU)
11 124,250,452 124,251,303 nonsense SNP G/C */Y 1000GP (CHBJPT)

Variations - CNVs

Chr Start End Type Sources
11 124,109,057 124,122,118 CopyNumber Variation_71393 (DGV)
11 124,121,285 124,121,286 CopyNumber Variation_41258 (DGV)

Haplotypes

Protein haplotypes were calculated using the 1000 genomes project as described in Olender T. et. al. BMC Genomics 2012.

Y35C S133G *259Y % Freq CORP
1 Y S * 51.46 1.200
2 Y S Y 48.31 0.377
3 Y G Y 0.15 0.377
4 C S Y 0.08 0.678

AceView Gene Models

The information is based on AceView gene models, constructed from cDNA sequences. The information might be incomplete.

Accession Type Chr Start End Strand
OR8G1.aApr07-unspliced main_exon CDS_partial chr11 124,250,050 124,250,521 +