Search Olfactory receptors

(e.g. OR1G1, AF087928, Segregating Pseudo)

Select ORs from

Family: Subfamily:

Chromosome:

Back to all Opossum symbols

Opossum Modo-ORUN2 Olfactory Receptor

Gene Symbol Modo-ORUN2
Organism Opossum
Family 0
Subfamily Modo-ORUN2
Pseudo No
Location scaffold_12795:0-1,903,520 (-)

Sequence information


Nucleotide sequence

ctTTCTTTTGTGTTGTTTTTTCATAACCTGTTGTCTATAAATTATAAGGCAAAGGCTGAA
ATCCTCATAGGAGCTAAGATAATTTCCTACAATGGATGTGCTGAATAGTTTTATATCTTT
GTTGTCTGTACTACTGTTGAAAGTGATCTGGCTGCTAGGGCTACTGCTCAACAGGCAGCT
TGGTGTGAGCTCCATTATATTTCCAACATGACTTCCAAAGTATGTGCCATTCTTTTCACT
GGTTCCTGAGGAGATGGTTTTAATTTAATTTTGACTTCTGTAGTTCATCAGTTTTGATGT
GATTTTCCATCATTTATGGCACTCTCTTGTTTTGGCTCAGGCATTAATGAATGGCTTGTC
TTCTCTGCTATGGGATTTGATCTTTTACTCATCTTAATGTCTTACTTATTCACTCTTATT
GTCATTCTTCACAATTTATTTATTCTGTTGGAGAGCAATCAGGA


Conceptual translation

LSFVLFFHNLLSINYKAKAEILIGAKIISYNGCAE*FYIFVVCTTVESDLAARATAQQAA
WCELHYISNMTSKVCAILFTGS*GDGFNLILTSVVHQF*CDFPSFMALSCFGSGINEWLV
FSAMGFDLLLILMSYLF/SYCHSSQFIYSVGEQSG