Search Olfactory receptors

(e.g. OR1G1, AF087928, Segregating Pseudo)

Select ORs from

Family: Subfamily:

Chromosome:

Back to all Mouse symbols

Mouse Or12e15-ps Olfactory Receptor

Gene Symbol Or12e15-ps
Organism Mouse
Family 12
Subfamily e
Pseudo Yes
Location chr2:87808272-87808665 (-)
Aliases Olfr1144-ps1, GA_x5J8B7W3Y5M-1094074-1093275, OTTMUSG000000

Sequence information


Nucleotide sequence

TTACTTATCACACTTAACACACTTCCTAACCTTCAAGGGATTCTGTCTGCACTGTTCTCC
ATCATTTACAGGATTATCCTCATCGGCAATTGCCTCATCATATTAATAACTAGGCTTGAT
CATGCATTGTAGAAACCCATGTATTTTTTTCCTGACAAATTTTTTCTCTCTGGAAATCTG
TTATATATCAGTTACTGTCCCAAGAATTCTCTTCAACATTTGGACACAGAATAGAAACAT
TTCTGTGCTGGCTTGTGTTGTGTAGATGTTTCTTTCTTATGTTGGGAACTGATGAATGTC
TCCTTATACAATGTATACACTTATCTGTACACTTACACAACTCTACAGATTAAAGTTTGG
AGCTAAACATTGCAGAAAACCCTGTACCTGTCTC


Conceptual translation

LLITLNTLPNLQGILSALFSIIYRIILIGNCLIILITRLDHAL*KPMYFF\TNFFSLEI
CYISVTVPRILFNIWTQNRNISVLACVV*MF/FL/LGTDECLLIQCIHLSVHLHN/Y
RLKFGAKHCRKPCTCL