Search Olfactory receptors

(e.g. OR1G1, AF087928, Segregating Pseudo)

Select ORs from

Family: Subfamily:

Chromosome:

Back to all Rat symbols

Rat Or4af1-ps Olfactory Receptor

Gene Symbol Or4af1-ps
Organism Rat
Family 4
Subfamily af
Pseudo Yes
Location chr3:78435795-78436570 (-)
Aliases Olr706-ps, Olr706-ps

Sequence information


Nucleotide sequence

TGTGCCCATGTCCCAGGGGACTTACATCCATGCTCACAAATTTAAGTCATGTTCTAGTCT
ACTGAATGTTACCTCTGAAACAAACCTTATCAAAAGGTCAATAGTAAAGGGAAGTAATCT
TACAGAATTTGCCCAAACTGACTTTACACAATATCCTGTTTGCTAAAAGCACTATTTATA
ATGGTGTATTCAACTTCGTTTTCATAACTGTGAGCTATGTGACCATTGCAGTGACAGATA
TGGCAGTCACTCCTTAGGTTATTCAGTGTACCTCTTGCTGCCTGCTACCCCTATGTGCTG
CTTATGCCACTTACCTCTCTCCAAATTTGGTTATATACTTAATCACTGATAAACTTACTA
TCTCTCCATCATACCTTTTATGGGACAGCTCCTTACCAAATAATTATCTATTGGTACTTA
GAACTTCTTGGTGGTGATGGCCTATGGTTGCTATTGGGGCCATCAGTAAGACATTGAAAT
ACATGCTAAACATGAGCTCTGTTGCATTTGTTTGCATCCTTTTGTGTTGTTGGCATGGGC
TGGAAGTTTTATGCACTCTTTGGTTCAATATTTTTATGTTTATAGTCTTCCATTCTGAGG
TCCTAATTTCATTGACCATTTCATATATGGCAATTATCCAGAATTAGAGTTTACTATTGA
TAAATCTTTTAAAATATACTATCACTTCAATTTTGAATCCTTTAACATCTTCAGAAATTA
TGAAACGAAAACTTCTGTGAAAAATCTCTGGTATGGAATTTCAACTGCAGATACTA


Conceptual translation

KGSNLTEFAQTDFTQYP/LLKALFIMVY/NFVFITVSYVTIAVT/YGSHSLGYSVYL
LLPATPM\AYATYLSPNLVIYLITDKLTISPSYL/MGQLLTK*LSIGT*NFLVVMAYG
CYW\ISKTLKYMLNMSSVAFVCILL/LLAWAGSFMHSLVQYFYVYSLPF*GPNFIDHF
IYGNYPELEFTIDKSFKI