Search Olfactory receptors

(e.g. OR1G1, AF087928, Segregating Pseudo)

Select ORs from

Family: Subfamily:

Chromosome:

Back to all Rat symbols

Rat Or5aa4-ps Olfactory Receptor

Gene Symbol Or5aa4-ps
Organism Rat
Family 5
Subfamily aa
Pseudo Yes
Location chr1:230022371-230022855 (-)
Aliases Olr353-ps, Olr353-ps

Sequence information


Nucleotide sequence

GATTGTGATTATACCAAGCTCCTCTCTATGAGTATTATTAGGAATCATTTTTTAGGAGCA
GGTACAGGGGGTATGTTTGGCTCAATCCTAGGTCCAGTGAGATTTTTCTTTTTCTTATTT
CAGGCTTCAATGTTATATTTGCACTATTCCTTATTTAGATCTCCCTTTGTAATTTATCAC
CATTTTGAAAACATGTTCTGGTGACGGACATTGGAGAGCACAATCTACCTCTACTTCTCA
TCTCACTGCTGCCATTCTCTTCATTGGGAGAGTCATCATCATGTATGTGTAACCTATCTC
CGTTCACAATATGGAAGCAGATAATATTGTATCTTTTGTCTACAATGTAGTTATCCTCTT
AATGCATTCTGTGGTCTCTATCTAGTCTGAGGGACATGAAGGTCAAAAGCACATGTGTAA
AGGTTATTCAGAAGGCAAATTTTCTTAAGAATTATTCATCAGCTGACATAAAATGCACTA
AAATG


Conceptual translation

SEIFLFLISGFNVIFALFLI*ISLCN/ITILKTCSGDGHWRAQSTSTSHLTAAILFIGR
VIIMYV*PISVHNMEADNIVSFVYNVVILLMHSVV\SSLRDMKVKSTCVKVIQKANFL