Search Olfactory receptors

(e.g. OR1G1, AF087928, Segregating Pseudo)

Select ORs from

Family: Subfamily:

Chromosome:

Back to all Rat symbols

Rat Or5ai2-ps Olfactory Receptor

Gene Symbol Or5ai2-ps
Organism Rat
Family 5
Subfamily ai
Pseudo Yes
Location chr3:72751576-72752436 (-)
Aliases Olr437-ps, Olr437-ps

Sequence information


Nucleotide sequence

CCTGGAGATAGTTAGAACAGAGAAAGCAATGCTCTGGGCTCAGCCCAAGCTCATATATTT
GCCCAGATTGAGTATGGCTCTCATCCCATTGCCAGAGTGAATAAAAGTTACTTTCACACT
GCAGAACTTCATGGCAGCAGCAAATGTATTGTCATTTGAAGGATGTGTAATGCAATTTGA
AACCCGTCGTTTTACTCCATGGAGCTATGGCAGTGGGTCATTATGCACCATCCATAAGAC
TCAGCACTACACACTCATTTCTCCACAAACATGCATCCACTTAGCAGCTGGTTCATATCT
TGTGTGGTTAATGAACCCACCTATTCATGGGCTTCAAACATTCCCAGTCCTTTTCTAAGT
CCAACATCTTCAATCACTTTTCCTGAAGTTCTCTCCCAATTCTCACCCACACTTGCTCCA
ATGACATCAACATCATCTTCTCAATGTGTTTGTAGGATTTAACCTGCTGTTCACTGATTT
CACTGGTGTTTACTATTATCTTCTCCTACATATGCATCATGGGTACCATCCAGAATTTCT
CTGCAAATCAGAAAGAAGGAAACTTTCTCCATATGTGCTTCCTAACTGACAGCAGTCACT
ATTTTTCATGGAACATTTGCTTATATATGTACAGCTTCATTCTGACCATTCTGAAAAAAA
GTATGAAAATGATCTCCATGTATTATTGAATTTTCATTGCCATGTTGAATACTCTCATCG
ATGGCTTGAGAAACACAGAAGTAAATCAAGAACTGAAGCATGAGCCTGGCATGTAGGTGT
ATGCTTTTAGTCCTAGCAAAGATGGGCAGACCTTGTAAATTCAAGATCAGCCTGGTCTTC
AGAGCAGTCAGGACTGTTAAC


Conceptual translation

MAAANVLSFEGCVMQFETRR/YSM/AMAVGHY/TIHKTQHYTLISPQTCIHLAAGSY
LVWLMNPPIHG\KHSQSFSKSNIFNHFS*SSLPILTHTCSNDINI/LLNVFVGFNLLF
T\SLVFTIIFSYICIMGTIQNFSA/S/KKETFSICAS*LTAVTIFHGTFAY//VQ
LHSDHSEK\MKMISMYY*IFIAMLNTLIDGLRNTEVNQELK