Search Olfactory receptors

(e.g. OR1G1, AF087928, Segregating Pseudo)

Select ORs from

Family: Subfamily:

Chromosome:

Back to all Rat symbols

Rat Or5ax1-ps Olfactory Receptor

Gene Symbol Or5ax1-ps
Organism Rat
Family 5
Subfamily ax
Pseudo Yes
Location chr1:230391144-230391841 (+)
Aliases Olr368-ps

Sequence information


Nucleotide sequence

CCATACTCATAGTTCAGATTTCATGGTAGTGTTGAATTAGCAAAACTTCTCATTTACTAA
TCTTCTCTTAGGTACCTGTCATAATTACTAAGTTATATTGATGGAGAATATTTCAGAGGC
AACTCAGGTTTTTCTTGTGGTCTGCACAGGTGCCACAGAACTTCAGATCCCATTACTTAT
CATTTCCACTGTCATTTATTTGACGATGCTGATTCAGAACCTTGAAATGATTACAGTGAT
TCTACTTGACTCCCTACTCCCCATTTTGATGTAATTTGTCTTCAGTAATATATACCTGAT
ACACTGTATGTATTCCTCAGAGGTAAGTCCCTAGATAATAGCAGGATTTCATACAAGAAA
TAAGATTATACCCTGTAGTATGCATTTTATAGTCTAGCTGGGGTTCTGCATCCTCTTTTC
TTCCCTCTCAGGGTGTACAGAAACAAATGCACTCAAGAATAGAAGGCTGAGGTAGAGTCT
GGATTGATTGGGTTTCTACAAAATCTTAATTTGACTGGGAGTATGTGACAGAAATTAGGT
GTAGAGTGAAAGACAAGGCCTCTGAACTCTGAAAATTCTTTTCAAAGTTTAATGTATTTT
ATTGGATATTTTATTTATATTTCAAATGTTATACCCTTTCCAGGTTTCCAGTACAGTATC
CCCCATGTCATCCTTTTACCCCCTGCCTCCATGAGCGT


Conceptual translation

MENISEATQVFLVVCTGATELQIPLLIISTVIYLTMLIQNLEMITVILLDSLLPILM*FV
FSNIYLIHCMYSSEVSP*IIAGFHTRNKIIPCSMHFIV*LGFCILFSSLSGCTETNALKN
RRLR