Search Olfactory receptors

(e.g. OR1G1, AF087928, Segregating Pseudo)

Select ORs from

Family: Subfamily:

Chromosome:

OR14A16 Olfactory Receptor

Gene Symbol OR14A161 (View this gene in GeneCards)
Family 14
Subfamily A
Pseudogene No
CORP pseudogene probability score 0.67 (pseudogene)
Aliases HsOR1.5.12
External Ids HGNC: 15022   
Build #39 labels OR5AT1
Chromosomal location 1:247,814,803-247,815,729 (-)
Cluster 1@248
Synteny CLIC#0
Remarks Belongs to OR14- a new family which is expanded in opossum and platypus. Was previously classified into family 5 with the symbol OR5AT1.

Most Similar ORs in Humans (Paralogs)

Symbol Percent Length
OR14L1P 52.61% 287
OR14A2 56.25% 304
OR14J1 51.77% 311

Most Similar ORs in other species (Orthologs)

Specie Symbol Percent Length
Dog OR14J1B 53% 311
Chimp CONTIG658.39-18298 97% 242
Mouse Or14a259 53% 310
Rat Or14a260b 52% 299
Cow OR14J1 52% 311

Expression evidences

Source Accession
mRNA AB463968

Sequence information

Nucleotide sequence ATGGCAAATCTCACAATCGTGACTGAATTTATCCTTATGGGGTTTTCTACCAATAAAAAT
ATGTGCATTTTGCATTCGATTCTCTTCTTGTTGATTTATTTGTGTGCCCTGATGGGGAAT
GTCCTCATTATCATGATCACAACTTTGGACCATCATCTCCACACCCCCGTGTATTTCTTC
TTGAAGAATCTATCTTTCTTGGATCTCTGCCTTATTTCAGTCACGGCTCCCAAATCTATC
GCCAATTCTTTGATACACAACAACTCCATTTCATTCCTTGGCTGTGTTTCCCAGGTCTTT
TTGTTGCTTTCTTCAGCATCTGCAGAGCTGCTCCTCCTCACGGTGATGTCCTTTGACCGC
TATACTGCTATATGTCACCCTCTGCACTATGATGTCATCATGGACAGGAGCACCTGTGTC
CAAAGAGCCACTGTGTCTTGGCTGTATGGGGGTCTGATTGCTGTGATGCACACAGCTGGC
ACCTTCTCCTTATCCTACTGTGGGTCCAACATGGTCCATCAGTTCTTCTGTGACATTCCC
CAGTTATTAGCTATTTCTTGCTCAGAAAATTTAATAAGAGAAATTGCACTCATCCTTATT
AATGTAGTTTTGGATTTCTGCTGTTTTATTGTCATCATCATTACCTATGTCCACGTCTTC
TCTACAGTCAAGAAGATCCCTTCCACAGAAGGCCAGTCAAAAGCCTACTCTATTTGCCTT
CCACACTTGCTGGTTGTGTTATTTCTTTCCACTGGATTCATTGCTTATCTGAAGCCAGCT
TCAGAGTCTCCTTCTATTTTGGATGCTGTAATTTCTGTGTTCTACACTATGCTGCCCCCA
ACCTTTAATCCCATTATATACAGTTTGAGAAACAAGGCCATAAAGGTGGCTCTGGGGATG
TTGATAAAGGGAAAGCTCACCAAAAAG
Conceptual translation

Protein domains and features

Variations - SNPs

Chr Start End Type Variation AA Change SNP IDs
1 247,978,542 247,978,544 Del(3) -/AGG rs35979231 (DbSNP)
1 247,978,544 247,978,546 Del(3) -/GAG rs60157395 (DbSNP)
1 247,978,544 247,978,546 In-Del(3) -/CTC rs74163811 (DbSNP)
1 247,978,319 247,978,319 NS A/G I/T rs6695283 (DbSNP)
1 247,978,517 247,978,517 NS A/G V/A rs74152818 (DbSNP)
1 247,978,436 247,978,436 NS C/A R/L rs61734861 (DbSNP)
1 247,978,135 247,978,135 SYN A/C G/G rs12734733 (DbSNP)
1 247,978,339 247,978,339 SYN A/G G/G rs6681046 (DbSNP)
1 247,978,996 247,978,996 SYN A/G L/L rs10888249 (DbSNP)
1 247,978,924 247,978,924 SYN A/G A/A rs56958172 (DbSNP)
1 247,978,768 247,978,768 SYN G/A N/N rs61740923 (DbSNP)
1 247,814,833 247,814,833 SNP C/A 1000GP (CEU)
1 247,815,017 247,815,017 SNP A/G 1000GP (CEU, CHBJPT)
1 247,815,037 247,815,037 SNP G/A 1000GP (CEU)
1 247,815,466 247,815,466 SNP G/A 1000GP (CEU)
1 247,815,622 247,815,622 SNP G/A 1000GP (CEU)
1 247,815,694 247,815,694 SNP A/G 1000GP (CEU, CHBJPT)
1 247,815,284 247,815,284 SNP T/C 1000GP (CHBJPT)
1 100 -100 SNP A/G 1000GP (YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI, YRI)

Variations - CNVs

Chr Start End Type Sources
1 247,753,334 248,322,316 CopyNumber Variation_2358 (DGV)
1 247,714,585 248,277,146 CopyNumber Variation_3339 (DGV)
1 247,074,430 248,328,835 CopyNumber Variation_6816 (DGV)
1 247,753,207 248,376,070 CopyNumber Variation_8353 (DGV)
1 247,849,473 248,277,638 CopyNumber Variation_48302 (DGV)
1 247,849,473 248,285,441 CopyNumber Variation_48303 (DGV)
1 247,976,105 247,979,131 Deletion #184 (Waszak)

Haplotypes

Protein haplotypes were calculated using the 1000 genomes project as described in Olender T. et. al. BMC Genomics 2012.

I238T L199R V172A Y149C L30F % Freq CORP
1 T L V Y L 92.93 0.213
2 T L A Y L 3.69 0.213
3 T L V C L 1.38 0.213
4 T L V Y F 1.00 0.213
5 T R V Y L 0.69 0.213
6 I L V Y L 0.31 0.500

AceView Gene Models

The information is based on AceView gene models, constructed from cDNA sequences. The information might be incomplete.

Accession Type Chr Start End Strand
OR5AT1.aApr07-unspliced main_exon 3UTR chr1 247,814,800 247,814,803 -
CDS chr1 247,814,803 247,815,729 -